Skip to Content
Merck

EMU083541

MISSION® esiRNA

targeting mouse Lpl

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTGGACATCGGAGAACTGCTCATGATGAAGCTTAAGTGGATGAGCGACTCCTACTTCAGCTGGCCCGACTGGTGGAGCAGCCCCAGCTTCGTCATCGAGAGGATCCGAGTGAAAGCCGGAGAGACTCAGAAAAAGGTCATCTTCTGTGCTAGGGAGAAAGTTTCTCATCTGCAGAAGGGAAAGGACTCAGCAGTGTTTGTGAAATGCCATGACAAGTCTCTGAAGAAGTCTGGCTGACACTGGACAAACAAACAAGAGAAGAAAGCATCCGAGTTCTTTGAAGACAGAAGAAAACAAAGTAAATTTAATTTAAAAAAATAATACCCTTGTTTGGGTGTTTGAAAGTGGGTTTTCCTGAGTATTAATCCCAGCTCTATCTTGTTAGTTAAACAGAAGACAGTCTCAAATATTAAACGGTGGCTAACCCAGGGTGAGGAATCTAATGGCCCATAGCAGGTCTTCCAGCATCAGAAGACATCAGGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed