Skip to Content
Merck

EHU044981

MISSION® esiRNA

targeting human SLC7A5

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGGCACCAAACTGGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATGGAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAGAAACCTGCCCCTGGCCATCATCATCTCCCTGCCCATCGTGACGCTGGTGTACGTGCTGACCAACCTGGCCTACTTCACCACCCTGTCCACCGAGCAGATGCTGTCGTCCGAGGCCGTGGCCGTGGACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCATCCCCGTCTTCGTGGGCCTGTCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAGGCTCTTCTTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCCACAGCTCCTCACCCCCGTGCCGTCCCTCGTGTTCACGTGTGTGATGACGCTGCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC7A5(8140)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ling Wei et al.
Cancer science, 107(3), 347-352 (2016-01-11)
3-(18)F-l-α-methyl-tyrosine ([18F]FAMT), a PET probe for tumor imaging, has advantages of high cancer-specificity and lower physiologic background. FAMT-PET has been proved useful in clinical studies for the prediction of prognosis, the assessment of therapy response and the differentiation of malignant
Yu Takahashi et al.
Pharmaceutical research, 35(12), 246-246 (2018-10-31)
The anti-epileptic drug pregabalin crosses the blood-brain barrier (BBB) in spite of its low lipophilicity. This study was performed to determine whether L-type amino acid transporters (LAT1/SLC7A5 and LAT2/SLC7A8) contribute to the uptake of pregabalin. Pregabalin uptake by LATs-transfected HEK293
Danting Cao et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1195-1206 (2020-03-28)
MicroRNA-126-3p (miR-126) is required for angiogenesis during organismal development or the repair of injured arterial vasculature. The role of miR-126 in lung microvascular endothelial cells, which are essential for gas exchange and for lung injury repair and regeneration, remains poorly