Skip to Content
Merck

EHU106961

MISSION® esiRNA

targeting human FKBP1A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGAATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGCTTTGCTTCCGACACCTCTGTTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FKBP1A(2280)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Mingyou Xing et al.
Cancer chemotherapy and pharmacology, 84(4), 861-872 (2019-08-21)
FK506-binding protein 12 (FKBP12) is abundant, ubiquitously expressed cytoplasmic protein with multiple functions in cell signaling transduction. Recently, we reported a novel function for FKBP12 in oncoprotein mouse double minute 2 (MDM2) self-ubiquitination and degradation, which greatly enhanced the sensitivity
Zicheng Wang et al.
Journal of cell science, 132(10) (2019-04-28)
Necroptosis is a regulated form of necrotic cell death that is mediated by receptor-interacting serine/threonine-protein kinase 1 (RIPK1), RIPK3 and mixed-lineage kinase domain-like protein (MLKL), which mediates necroptotic signal transduction induced by tumor necrosis factor (TNF). Although many target proteins
Itziar M D Posada et al.
Oncotarget, 8(27), 44550-44566 (2017-06-01)
Currently several combination treatments of mTor- and Ras-pathway inhibitors are being tested in cancer therapy. While multiple feedback loops render these central signaling pathways robust, they complicate drug targeting.Here, we describe a novel H-ras specific feedback, which leads to an