Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCTGATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAGAATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTTCAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTTCAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATGTGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGAAAGCAAAAGGACAAGAACAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TERF1(7013)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Surya Shin Ichi Sutanto et al.
Journal of cell communication and signaling, 13(4), 523-530 (2019-06-17)
People with diabetes mellitus have shorter telomeres compared with non-diabetic subjects. The aim of this study was to investigate an in-vitro model of telomere shortening under diabetes metabolic conditions. The mechanisms of the accelerated telomere length attrition and the potential
Lu Yang et al.
Nucleic acids research, 45(7), 3906-3921 (2017-02-06)
Oxidative DNA damage triggers telomere erosion and cellular senescence. However, how repair is initiated at telomeres is largely unknown. Here, we found unlike PARP1-mediated Poly-ADP-Ribosylation (PARylation) at genomic damage sites, PARylation at telomeres is mainly dependent on tankyrase1 (TNKS1). TNKS1
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific