Skip to Content
Merck

EHU131981

MISSION® esiRNA

targeting human HBP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGGAGTTGCTGCAGTGTAATGAGAATTTGCCATCTTCACCTGGATATAACTCCTGTGATGAACACATGGAGCTTGATGACCTTCCTGAACTTCAGGCAGTTCAAAGTGATCCTACCCAATCTGGCATGTACCAGCTGAGTTCAGATGTTTCACATCAAGAATACCCAAGATCATCTTGGAACCAAAATACCTCAGACATACCAGAAACTACTTACCGTGAAAATGAGGTGGACTGGCTAACAGAATTGGCAAATATCGCGACCAGTCCACAAAGTCCACTGATGCAGTGCTCATTTTACAATAGATCATCTCCTGTACACATCATAGCCACTAGCAAAAGTTTACATTCCTATGCACGCCCTCCACCAGTGTCCTCTTCTTCGAAGAGTGAACCAGCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HBP1(26959)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Z Z Yao et al.
Journal of biological regulators and homeostatic agents, 34(2), 357-366 (2020-06-19)
This study aims to explore the effect of p38 mitogen-activated protein kinase and its downstream target HMG-box transcription factor 1 (HBP1) in the chondrocyte (CH) senescence caused by hyperosmotic stress. Human cartilage tissue with or without osteoarthritis (OA) were collected
Zhiyong Yan et al.
FEBS letters, 588(17), 3038-3046 (2014-06-17)
We found that miR-96 is overexpressed in glioma, and its level inversely correlates with the survival of patients. The reduction in miR-96 abundance suppresses the proliferation and colony formation of glioma cells. The tumorigenicity of U-87 MG cells is reduced
Ruo-Chia Tseng et al.
Journal of cellular and molecular medicine, 18(9), 1752-1761 (2014-06-05)
β-catenin nuclear accumulation is frequently identified in human non-small cell lung cancer (NSCLC). The HMG-box transcription factor 1 (HBP1) is a known repressor of β-catenin transactivation. However, the role of HBP1 in relation to β-catenin nuclear accumulation has not been