Skip to Content
Merck

EHU133491

MISSION® esiRNA

targeting human SH3PXD2A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCCAAGAGTGAGGATTCGGAGCTGCCCCCGCAGACGGCCTCCGAGGCTCCCAGTGAGGGGTCTAGGAGAAGCTCATCCGACCTCATCACCCTCCCAGCCACCACTCCCCCATGTCCCACCAAGAAGGAATGGGAAGGGCCAGCCACCTCGTACATGACATGCAGCGCCTACCAGAAGGTCCAGGACTCGGAGATCAGCTTCCCCGCGGGCGTGGAGGTGCAGGTGCTGGAGAAGCAGGAGAGCGGGTGGTGGTATGTGAGGTTTGGGGAGCTGGAGGGCTGGGCCCCTTCCCACTATTTGGTGCTGGATGAGAACGAGCAACCTGACCCCTCTGGCAAAGAGCTGGACACAGTGCCCGCCAAGGGCAGGCAGAACGAAGGCAAATCAGACAGCCTGGAGAAGATCGAGAGGCGCGTCCAAGCACTGAACACCGTCAACCAGAGCAAGAAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SH3PXD2A(9644)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Serisha Moodley et al.
Oncotarget, 7(47), 76437-76452 (2016-11-12)
Repair of airway epithelium after injury requires migration of neighboring epithelial cells to injured areas. However, the molecular mechanisms regulating airway epithelial cell migration is not well defined. We have previously shown that XB130, a scaffold protein, is required for
Katrina M Wisdom et al.
Nature communications, 9(1), 4144-4144 (2018-10-10)
Studies of cancer cell migration have found two modes: one that is protease-independent, requiring micron-sized pores or channels for cells to squeeze through, and one that is protease-dependent, relevant for confining nanoporous matrices such as basement membranes (BMs). However, many
M Roh-Johnson et al.
Oncogene, 33(33), 4203-4212 (2013-09-24)
Most cancer patients die as a result of metastasis, thus it is important to understand the molecular mechanisms of dissemination, including intra- and extravasation. Although the mechanisms of extravasation have been vastly studied in vitro and in vivo, the process