Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTCCAAGAGTGAGGATTCGGAGCTGCCCCCGCAGACGGCCTCCGAGGCTCCCAGTGAGGGGTCTAGGAGAAGCTCATCCGACCTCATCACCCTCCCAGCCACCACTCCCCCATGTCCCACCAAGAAGGAATGGGAAGGGCCAGCCACCTCGTACATGACATGCAGCGCCTACCAGAAGGTCCAGGACTCGGAGATCAGCTTCCCCGCGGGCGTGGAGGTGCAGGTGCTGGAGAAGCAGGAGAGCGGGTGGTGGTATGTGAGGTTTGGGGAGCTGGAGGGCTGGGCCCCTTCCCACTATTTGGTGCTGGATGAGAACGAGCAACCTGACCCCTCTGGCAAAGAGCTGGACACAGTGCCCGCCAAGGGCAGGCAGAACGAAGGCAAATCAGACAGCCTGGAGAAGATCGAGAGGCGCGTCCAAGCACTGAACACCGTCAACCAGAGCAAGAAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SH3PXD2A(9644)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Serisha Moodley et al.
Oncotarget, 7(47), 76437-76452 (2016-11-12)
Repair of airway epithelium after injury requires migration of neighboring epithelial cells to injured areas. However, the molecular mechanisms regulating airway epithelial cell migration is not well defined. We have previously shown that XB130, a scaffold protein, is required for
Katrina M Wisdom et al.
Nature communications, 9(1), 4144-4144 (2018-10-10)
Studies of cancer cell migration have found two modes: one that is protease-independent, requiring micron-sized pores or channels for cells to squeeze through, and one that is protease-dependent, relevant for confining nanoporous matrices such as basement membranes (BMs). However, many
M Roh-Johnson et al.
Oncogene, 33(33), 4203-4212 (2013-09-24)
Most cancer patients die as a result of metastasis, thus it is important to understand the molecular mechanisms of dissemination, including intra- and extravasation. Although the mechanisms of extravasation have been vastly studied in vitro and in vivo, the process