Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGACTTGGCCGAGGAGCGGGGCCACCGCGACGTTGCAGGGTACCTGCGCACAGCCACGGGGGACTGACGCCAGGTTCCCCAGCCGCCCACAACGACTTTATTTTCTTACCCAATTTCCCACCCCCACCCACCTAATTCGATGAAGGCTGCCAACGGGGAGCGGCGGAAAGCCTGTAAGCCTGCAAGCCTGTCTGAGACTCACAGGAAGGAGGAGCCGACCGGGAATAACCTTCCATACATTTTTTTCTTTGTCTTATCTGGCCCTCGACACTCACCATGAAGCGAAACACAGAGAAGCGGATTTCCAGGGATATTTAGGAGTGTGTGACATTCCAGGGGTCGTTTGCTTTTCAGGGTTTTCTGAGGGAAAGTGCATATGAAATCCTTGACTGGACCTGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDKN2B(1030)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiangeng Yang et al.
Oncotarget, 8(40), 68721-68729 (2017-10-06)
Hsa-miR-429 is increased in bladder cancer. Its roles in bladder cancer are poorly understood. The expression levels of hsa-miR-429 and cyclin-dependent kinase inhibitor 2B (CDKN2B) were determined using Real-Time qPCR in a total of 50 patients with bladder cancer. Bladder
Mu Xu et al.
Molecular cancer, 17(1), 141-141 (2018-09-30)
Mounting evidence demonstrates that long noncoding RNAs (lncRNAs) have critical roles during the initiation and progression of cancers. In this study, we report that the small nucleolar RNA host gene 1 (SNHG1) is involved in colorectal cancer progression. We analyzed
Steven K Huang et al.
PloS one, 9(9), e107055-e107055 (2014-09-13)
Excessive fibroproliferation is a central hallmark of idiopathic pulmonary fibrosis (IPF), a chronic, progressive disorder that results in impaired gas exchange and respiratory failure. Fibroblasts are the key effector cells in IPF, and aberrant expression of multiple genes contributes to