Skip to Content
Merck

EHU153641

MISSION® esiRNA

targeting human HRH4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGAATGGGCCAATGATTCTAGTTTCAGAGTCTTGGAAGGATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGGAATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGATCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTCAGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGAGACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAAAATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HRH4(59340)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Anne-France Petit-Bertron et al.
PloS one, 4(8), e6504-e6504 (2009-08-08)
The most recently characterized H4 histamine receptor (H4R) is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 38(3), 204-212 (2018-06-05)
Mast cell (MC) activation through H4R releases various inflammatory mediators which are associated with allergic asthma. To investigate the siRNA-mediated gene silencing effect of H4R on human mast cells (HMCs) functions and the activation of stress-activated protein kinases (SAPK)/jun amino-terminal
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 37(2), 133-140 (2016-07-13)
The histamine H4 receptor functionally expressed on human mast cells and their signaling pathways for the production of IL-13 and RANTES have never been analyzed side by side in a directly comparable manner. Therefore, the aim of the study was