Skip to Content
Merck

EHU154181

MISSION® esiRNA

targeting human NOL3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGACGAGTCCGAAGATTCCTGAAGGCCAGAGCTCTGACAGGCGGTGCCCCGCCCATGCTGGATAGGACCTGGGATGCTGCTGGAGCTGAATCGGATGCCACCAAGGCTCGGTCCAGCCCAGTACCGCTGGAAGTGAATAAACTCCGGAGGGTCGGACGGGACCTGGGCTCTCTCCACGATTCTGGCTGTTTGCCCAGGAACTTAGGGTGGGTACCTCTGAGTCCCAGGGACCTGGGCAGGCCCAAGCCCACCACGAGCATCATCCAGTCCTCAGCCCTAATCTGCCCTTAGGAGTCCAGGCTGCACCCTGGAGATCCCAAACCTAGCCCCCTAGTGGGACAAGGACCTGACCCTCCTGCCCGCATACACAACCCATTTCCCCTGGTGAGCCACTTGGCAGCATATGTAGGTACCAGCTCAACCCCACGCAAGTTCCTGAGCTGAACATGGAGCAAGGGGAGGGTGACTTCTCTCCACATAGGGAGGGCTTAGAGCTCACAGCCTTGGGAAGTGAGACTAGAAGAGGGGAGCAGAAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NOL3(8996)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Fang Xie et al.
Acta physiologica (Oxford, England), 228(2), e13337-e13337 (2019-07-02)
Cardiac hypertrophy and myocardial apoptosis are two major factors in heart failure. As a classical regulator of apoptosis, apoptosis repressor with caspase recruitment domain (ARC) has recently also been found to have a protective effect against hypertrophy. However, the mechanism
Csaba Toth et al.
Cell communication and signaling : CCS, 15(1), 16-16 (2017-05-04)
Renal cell carcinomas (RCCs) display broad resistance against conventional radio- and chemotherapies, which is due at least in part to impairments in both extrinsic and intrinsic apoptotic pathways. One important anti-apoptotic factor that is strongly overexpressed in RCCs and known
Christopher DeBoever et al.
Nature communications, 9(1), 1612-1612 (2018-04-25)
Protein-truncating variants can have profound effects on gene function and are critical for clinical genome interpretation and generating therapeutic hypotheses, but their relevance to medical phenotypes has not been systematically assessed. Here, we characterize the effect of 18,228 protein-truncating variants