Skip to Content
Merck

EHU068551

MISSION® esiRNA

targeting human YTHDF2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

NCBI accession no.

shipped in

ambient

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTGAGTCCACAGGCAAGGCCCAATAATGCATATACTGCCATGTCAGATTCCTACTTACCCAGTTACTACAGTCCCTCCATTGGCTTCTCCTATTCTTTGGGTGAAGCTGCTTGGTCTACGGGGGGTGACACAGCCATGCCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCCCCACTTCCTACCAGATGCAATGTTTGGGCAACCAGGAGCCCTAGGTAGCACTCCATTTCTTGGTCAGCATGGTTTTAATTTCTTTCCCAGTGGGATTGACTTCTCAGCATGGGGAAATAACAGTTCTCAGGGACAGTCTACTCAGAGCTCTGGATATAGTAGCAATTATGCTTATGCACCTAGCTCCTTAGGTGGAGCCATGATTGATGGACAGTCAGCTTTTGCCAATGA

Ensembl | human accession no.

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chuanzhao Zhang et al.
Oncogene, 39(23), 4507-4518 (2020-05-06)
N6-methyladenosine (m6A) RNA methylation contributes to the cancer stem cell (CSC) phenotype through regulating gene expression. YTHDF2, an m6A reader, was shown to be associated with hepatocellular carcinoma (HCC) patient prognosis. However, the effect of YTHDF2 on liver CSC and
Sara Zaccara et al.
Cell, 181(7), 1582-1595 (2020-06-04)
N6-methyladenosine (m6A) is the most abundant mRNA nucleotide modification and regulates critical aspects of cellular physiology and differentiation. m6A is thought to mediate its effects through a complex network of interactions between different m6A sites and three functionally distinct cytoplasmic
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs
Yang Liu et al.
Science (New York, N.Y.), 365(6458), 1171-1176 (2019-08-24)
Host cell metabolism can be modulated by viral infection, affecting viral survival or clearance. Yet the cellular metabolism rewiring mediated by the N6-methyladenosine (m6A) modification in interactions between virus and host remains largely unknown. Here we report that in response

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service