Skip to Content
Merck

EHU086621

MISSION® esiRNA

targeting human TLR4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TLR4(7099)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Rui Guo et al.
Scientific reports, 6, 32447-32447 (2016-09-02)
Acute liver disease is characterized by inflammation, oxidative stress and necrosis, which can greatly influence the long term clinical outcome and lead to liver failure or cancer. Here, we initially demonstrated the beneficial role of caspase-9-dependent autophagy in acute liver
Daniela Verzola et al.
Journal of cachexia, sarcopenia and muscle, 8(1), 131-144 (2016-11-30)
Inflammation in skeletal muscle is implicated in the pathogenesis of insulin resistance and cachexia but why uremia up-regulates pro-inflammatory cytokines is unknown. Toll-like receptors (TLRs) regulate locally the innate immune responses, but it is unknown whether in chronic kidney disease
Emmeline L Blanchard et al.
Molecular therapy. Nucleic acids, 14, 52-66 (2018-12-24)
The characterization of innate immune activation is crucial for vaccine and therapeutic development, including RNA-based vaccines, a promising approach. Current measurement methods quantify type I interferon and inflammatory cytokine production, but they do not allow for the isolation of individual pathways, do