Skip to Content
Merck

EMU064061

MISSION® esiRNA

targeting mouse Mcl1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGCGGCATCAGAAATGTGCTGCTGGCTTTTGCGGGTGTTGCTGGAGTAGGGGCTGGTCTGGCATATCTAATAAGATAGCCTTGTGAGTGCAATAGGGGACTCTTAAAGCTCCAGCCACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTGCCCAGGATTTTAACAGTCCAGTTCTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATAAATACATGGGAAAAGTGCTCCCCCTGGAAGAGTCACTGTCTGAATGAAGCAAAGTTCCCTCTCAGCAAACACTGAGAGGCCATGGAGAAGGACTTCTAGAATGAATGAAAGGGGTGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Tadashi Inoue et al.
Human molecular genetics, 23(21), 5672-5682 (2014-06-09)
Latent TGF-β-binding protein-2 (LTBP-2) is an extracellular matrix protein associated with microfibrils. Homozygous mutations in LTBP2 have been found in humans with genetic eye diseases such as congenital glaucoma and microspherophakia, indicating a critical role of the protein in eye