EHU073721
MISSION® esiRNA
targeting human TRPV1
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGGACAAGTGGGACAGATTCGTCAAGCGCATCTTCTACTTCAACTTCCTGGTCTACTGCCTGTACATGATCATCTTCACCATGGCTGCCTACTACAGGCCCGTGGATGGCTTGCCTCCCTTTAAGATGGAAAAAACTGGAGACTATTTCCGAGTTACTGGAGAGATCCTGTCTGTGTTAGGAGGAGTCTACTTCTTTTTCCGAGGGATTCAGTATTTCCTGCAGAGGCGGCCGTCGATGAAGACCCTGTTTGTGGACAGCTACAGTGAGATGCTTTTCTTTCTGCAGTCACTGTTCATGCTGGCCACCGTGGTGCTGTACTTCAGCCACCTCAAGGAGTATGTGGCTTCCATGGTATTCTCCCTGGCCTTGGGCTGGACCAACATGCTCTACTACACCCGCGGTTTC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRPV1(7442)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Ayumi Maeda et al.
Molecular nutrition & food research, 62(11), e1800086-e1800086 (2018-04-24)
The prevalence of type 2 diabetes mellitus (T2DM) is increasing yearly worldwide. Glycemic control is the basis for the treatment of T2DM, as it can prevent the progress of associated complications. Spices possess various health beneficial effects on humans. The
Gwan Hee Han et al.
Cancer genomics & proteomics, 17(3), 309-319 (2020-04-30)
Transient receptor potential vanilloid type 1 (TRPV1) has been studied in human malignancies, but has not been studied in epithelial ovarian cancer (EOC). We, therefore, investigated the significance of TRPV1 and correlation with phosphatase and tension homolog (PTEN) in EOC.
Mingming Ren et al.
Cardiovascular therapeutics, 34(6), 482-488 (2016-09-24)
Accumulating evidence showed that transient receptor potential channels play an important role in the regulation of cardiomyocyte differentiation. The vanilloid receptor 1 (VR1) is a member of the transient receptor channel super family and is expressed in cardiomyocytes. However, its