Saltar al contenido
Merck

EMU046561

MISSION® esiRNA

targeting mouse Atpif1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAGCTGAGCAACGCCGAAGACAATGGCAGGCTCGGCGTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATGAAGGTCCTGCAAACCCGAGGCTTCGTCTCGGACTCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCCGAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAAAGAACAGCTGGCTGCCCTGAGGAAACACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGTCTGCAGAAGCAAATTGAACGCCATAAGAAGAAGATCCAACAACTAAAGAATAATCATTGAATGCGCGCAGTCGGTCCCTCACAGAGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico