Skip to Content
Merck

EHU089961

MISSION® esiRNA

targeting human LYN

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGGGAATGGCATACATCGAGCGGAAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAAGAAAAGGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LYN(4067)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Shuaibin Liu et al.
Oncotarget, 7(46), 75468-75481 (2016-10-01)
Cervical cancer is one of the most common malignant tumor in women. The mechanisms of cervical cancer are intricate and have not been fully understood. Therefore, we employed iTRAQ to obtain novel proteins profile which participates in the tumor oncogenesis
Xiaoyun Wang et al.
Scientific reports, 7, 42675-42675 (2017-02-17)
Hypersecretion of mucus is an important component of airway remodeling and contributes to the mucus plugs and airflow obstruction associated with severe asthma phenotypes. Lyn has been shown to down-regulate allergen-induced airway inflammation. However, the role of Lyn in mucin
Lei Meng et al.
Acta biochimica et biophysica Sinica, 52(1), 49-57 (2019-12-13)
Gastric cancer (GC) is one of malignant tumors with high mortality and morbidity in the world. MicroRNA-122 (miR-122) acts as a tumor suppressor in a variety of cancers and has been found to be dominant in gastric adenocarcinoma. However, the