Skip to Content
Merck

EHU158481

MISSION® esiRNA

targeting human CHEK2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHEK2(11200)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



T-Y Chen et al.
Oncogenesis, 4, e180-e180 (2015-12-23)
The antitumor drug etoposide (ETO) is widely used in treating several cancers, including adrenocortical tumor (ACT). However, when used at sublethal doses, tumor cells still survive and are more susceptible to the recurring tumor due to centrosome amplification. Here, we
Thomas Ströbel et al.
Scientific reports, 7(1), 9674-9674 (2017-08-31)
Ape1 is the major apurinic/apyrimidinic (AP) endonuclease activity in mammalian cells, and a key factor in base-excision repair of DNA. High expression or aberrant subcellular distribution of Ape1 has been detected in many cancer types, correlated with drug response, tumor
Wei Liu et al.
Oncotarget, 9(1), 346-360 (2018-02-09)
Despite advances in deciphering the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), patients with relapsed/refractory disease, particularly those with adverse genetic features (e.g., mutated p53 or double hit lymphoma (DHL)) have very poor prognoses, and effective therapies are lacking.