Skip to Content
Merck

EHU063441

MISSION® esiRNA

targeting human PACSIN2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human PACSIN2

Gene Information

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGAAGACGCAGAACAACAGAAATAGCCGCCCCTCCCCGCCCACTGTGCCTGTTGGCCTATCATAGATCTCTATGTTCTTGACTTTGTCTCTCCTTTCCGAGTCAATGGTGGGTTACACTGATCTTGTTCCACTGATTACTCTCTCTGACGAGTCCATCACCTGCAACTTAAATGAACAAGCTTACATCCCATTTTGAGTGAAGATTTTGAGGTTTTTAATTTAAAGGCTGTGTACAGTTATACTTTTTTATACACCTGTTCATTTCTACTTAAATTATGGCACAGATTGATGCGCACCAGTCTTGAGGAAACGATCTCCCTATTCCCTTACCCTGTTACTCAGCCACGCCGTGTGTAGGCTTAGCCTCAGGTGGCAGATGTTTGAGGAAAGGAATTATGCCAGGAAGGTGGGACCGGGTTATGGTCGGGTTTCTATTGGGAATGCTCTTTGTGCTTTTGGGCATCTGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaohe Tian et al.
Science advances, 6(48) (2020-11-29)
The blood-brain barrier is made of polarized brain endothelial cells (BECs) phenotypically conditioned by the central nervous system (CNS). Although transport across BECs is of paramount importance for nutrient uptake as well as ridding the brain of waste products, the
Meagan M Postema et al.
Molecular biology of the cell, 30(19), 2515-2526 (2019-08-08)
Apical microvilli are critical for the homeostasis of transporting epithelia, yet mechanisms that control the assembly and morphology of these protrusions remain poorly understood. Previous studies in intestinal epithelial cell lines suggested a role for the F-BAR domain protein PACSIN2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service