Skip to Content
Merck

EHU108271

MISSION® esiRNA

targeting human BRD7

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGTGATTTCAGCATCCATGAGTTTTTGGCCACGTGCCAAGATTATCCGTATGTCATGGCAGATAGTTTACTGGATGTTTTAACAAAAGGAGGGCATTCCAGGACCCTACAAGAGATGGAGATGTCATTGCCTGAAGATGAAGGCCATACTAGGACACTTGACACAGCAAAAGAAATGGAGATTACAGAAGTAGAGCCACCAGGGCGTTTGGACTCCAGTACTCAAGACAGGCTCATAGCGCTGAAAGCAGTAACAAATTTTGGCGTTCCAGTTGAAGTTTTTGACTCTGAAGAAGCTGAAATATTCCAGAAGAAACTTGATGAGACCACCAGATTGCTCAGGGAACTCCAGGAAGCCCAGAATGAACGTTTGAGCACCAGACCCCCTCCGAACATGATCTGTCTCTTGGGTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRD7(29117)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiao-Meng Wang et al.
Journal of cellular and molecular medicine, 21(6), 1094-1105 (2016-12-14)
Bromodomain-containing protein 7 (BRD7) is a tumour suppressor that is known to regulate many pathological processes including cell growth, apoptosis and cell cycle. Endoplasmic reticulum (ER) stress-induced apoptosis plays a key role in diabetic cardiomyopathy (DCM). However, the molecular mechanism
Lena Golick et al.
Cellular and molecular life sciences : CMLS, 75(10), 1857-1869 (2017-11-12)
Reduced hepatic expression levels of bromodomain-containing protein 7 (BRD7) have been suggested to play a role in the development of glucose intolerance in obesity. However, the molecular mechanism by which BRD7 regulates glucose metabolism has remained unclear. Here, we show
Weihong Niu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 30-30 (2020-02-08)
BRD7 is a tumor suppressor known to inhibit cell proliferation and cell cycle progression and initiate apoptosis in breast cancer. However, the function and underlying molecular events of BRD7 in tumor invasion and metastasis in breast cancer are not fully