Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGCAAGTGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HSPD1(3329)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Justin F Deniset et al.
Cellular signalling, 47, 44-51 (2018-03-30)
Heat shock protein 60 (Hsp60) is a mediator of stress-induced vascular smooth muscle cell (VSMC) proliferation. This study will determine, first, if the mitochondrial or cytoplasmic localization of Hsp60 is critical to VSMC proliferation and, second, the mechanism of Hsp60
Bor-Hwang Kang et al.
Scientific reports, 9(1), 8932-8932 (2019-06-22)
Buccal mucosa squamous cell carcinoma (BMSCC) is one of major subsites of oral cancer and is associated with a high rate of metastasis and poor prognosis. Heat shock proteins (HSPs) act as potential prognostic biomarkers in many cancer types. However
Sharmin Afroz et al.
Virus research, 261, 37-49 (2018-12-15)
The UL47 gene product, VP8, is a major tegument protein of BoHV-1. While VP8 is not essential for virus replication in cell culture, a UL47-deleted virus exhibits a smaller tegument structure and is avirulent in cattle. To obtain pure VP8