Skip to Content
Merck

EMU040051

MISSION® esiRNA

targeting mouse Hsf1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGTCAAGCCTGAGAGAGATGACACCGAGTTCCAGCATCCTTGTTTCTTGCGTGGACAGGAACAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGCGTGTCCACCCTGAAGAGTGAGGACATAAAAATACGCCAGGACAGTGTCACCCGGCTGTTGACAGATGTGCAGCTGATGAAGGGGAAACAGGAGTGTATGGACTCCAAGCTCCTGGCCATGAAGCACGAGAACGAGGCCCTGTGGCGGGAGGTGGCCAGCCTTCGGCAGAAGCATGCCCAGCAGCAAAAAGTTGTCAACAAGCTCATTCAGTTCCTGATCTCACTGGTGCAGTCGAACCGGATCCTGGGGGTGAAGAGAAAGATCCCTCTGATGTTGAGTGACAGCAACTCAGCACACTCTGTGCCCAAGTATGGTCGACAGTACTCCCTGGAGCATGTCCATGGTCCTGGCCCATACTCAGCTCCATCTCCAGCCTACAGCAGCTCTAGCCTTTACTCCTCTGATGCTGTCACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX
Bin Wang et al.
Breast cancer research and treatment, 153(1), 57-66 (2015-08-01)
Heat shock factor 1 (HSF1) has long been recognized as the master transcription factor that regulates heat shock proteins (HSPs).  More recently HSF1 has been associated with a broader role in regulating response to a variety of cellular stresses beyond