Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCCGGGGAGAGACACGCTGTGAACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LAMP1(3916)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Keren Zhou et al.
Stroke, 49(1), 175-183 (2017-12-24)
The NLRP3 (nucleotide binding and oligomerization domain-like receptor family pyrin domain-containing 3) inflammasome is a crucial component of the inflammatory response in early brain injury after subarachnoid hemorrhage (SAH). In this study, we investigated a role of dihydrolipoic acid (DHLA)
Anders P Mutvei et al.
Nature communications, 11(1), 1416-1416 (2020-03-19)
The kinase mTOR complex 1 (mTORC1) promotes cellular growth and is frequently dysregulated in cancers. In response to nutrients, mTORC1 is activated on lysosomes by Rag and Rheb guanosine triphosphatases (GTPases) and drives biosynthetic processes. How limitations in nutrients suppress
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent