Skip to Content
Merck

EHU028781

MISSION® esiRNA

targeting human LAMP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCCGGGGAGAGACACGCTGTGAACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LAMP1(3916)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Keren Zhou et al.
Stroke, 49(1), 175-183 (2017-12-24)
The NLRP3 (nucleotide binding and oligomerization domain-like receptor family pyrin domain-containing 3) inflammasome is a crucial component of the inflammatory response in early brain injury after subarachnoid hemorrhage (SAH). In this study, we investigated a role of dihydrolipoic acid (DHLA)
Anders P Mutvei et al.
Nature communications, 11(1), 1416-1416 (2020-03-19)
The kinase mTOR complex 1 (mTORC1) promotes cellular growth and is frequently dysregulated in cancers. In response to nutrients, mTORC1 is activated on lysosomes by Rag and Rheb guanosine triphosphatases (GTPases) and drives biosynthetic processes. How limitations in nutrients suppress
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent