Skip to Content
Merck

EHU041011

MISSION® esiRNA

targeting human HPSE

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCGAATGGGAATAGAAGTGGTGATGAGGCAAGTATTCTTTGGAGCAGGAAACTACCATTTAGTGGATGAAAACTTCGATCCTTTACCTGATTATTGGCTATCTCTTCTGTTCAAGAAATTGGTGGGCACCAAGGTGTTAATGGCAAGCGTGCAAGGTTCAAAGAGAAGGAAGCTTCGAGTATACCTTCATTGCACAAACACTGACAATCCAAGGTATAAAGAAGGAGATTTAACTCTGTATGCCATAAACCTCCATAATGTCACCAAGTACTTGCGGTTACCCTATCCTTTTTCTAACAAGCAAGTGGATAAATACCTTCTAAGACCTTTGGGACCTCATGGATTACTTTCCAAATCTGTCCAACTCAATGGTCTAACTCTAAAGATGGTGGATGATCAAACCTTGCCACCTTTAATGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HPSE(10855)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Marjolein Garsen et al.
The American journal of pathology, 186(4), 805-815 (2016-02-14)
Heparanase, a heparan sulfate (HS)--specific endoglucuronidase, mediates the onset of proteinuria and renal damage during experimental diabetic nephropathy. Glomerular heparanase expression is increased in most proteinuric diseases. Herein, we evaluated the role of heparanase in two models of experimental glomerulonephritis
Jianping Li et al.
American journal of cancer research, 7(2), 234-244 (2017-03-25)
Heparanase (HPSE1) is elevated in various types of cancers including cervical cancer, and correlated with poor prognosis. Current study is to investigate the effects of HPSE1 on radiation response in cervical cancer. Colony formation assays after radiation were performed to
Uri Barash et al.
International journal of cancer, 145(6), 1596-1608 (2019-04-30)
Heparanase is an endo-β-d-glucuronidase that cleaves heparan sulfate (HS) side chains of heparan sulfate proteoglycans. Compelling evidence tie heparanase levels with all steps of tumor formation including tumor initiation, growth, metastasis and chemo-resistance, likely involving augmentation of signaling pathways and