Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PRKAA2(5563)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lin Lin et al.
Frontiers in pharmacology, 10, 1617-1617 (2020-02-13)
The increase of blood pressure accelerates endothelial progenitor cells (EPCs) senescence, hence a significant reduction in the number of EPCs is common in patients with hypertension. Autophagy is a defense and stress regulation mechanism to assist cell homeostasis and organelle
Meera Saxena et al.
Journal of cell science, 131(14) (2018-06-29)
The developmental programme of epithelial-mesenchymal transition (EMT), involving loss of epithelial and acquisition of mesenchymal properties, plays an important role in the invasion-metastasis cascade of cancer cells. In the present study, we show that activation of AMP-activated protein kinase (AMPK)
Wei-Wen Su et al.
International journal of medical sciences, 17(5), 678-684 (2020-03-27)
Background: Adenine exhibits potential anticancer activity against several types of malignancies. However, whether adenine has anticancer effects on hepatocellular carcinoma (HCC) cells is incompletely explored. Methods: Human HCC cell lines HepG2 and SK-Hep-1 (p53-wild type) and Hep3B (p53-deficient) were used