Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCTTCTAGAACTGGCATCCACCACTAAGTGTAGCTCAGTGAAATATGATGTTGAAATAGTAGAGGAATACTTCGCTCGACAGATCTCATCCTTCTGTAGTATCGACTGTACCACCATCTTGCAGCTGCATGAAATTCCCAGTCTGCAGTCCATCTACACCCTTGATGCCGCGATCTCAAAGGTCCAGGTCTCTTTGGATGAGCATTTTTCTAAGATGGCTGCTGAGACTGATCCTCATAAGTCGTCTGAGATTACCAAGAACCTACTTCCAGCCACGCTGCAACTCATTGACACCTATGCATCGTTCACCAGAGCCTATTTGCTGCAAAACTTTAATGAAGAGGGAACAACTGAGAAACCTTCCAAGGAGAAACTGCAAGGCTTTGCTGCTGTTTTGGCTATTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UBR4(23352)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Harrod H Ling et al.
PloS one, 9(8), e103103-e103103 (2014-08-02)
Circadian rhythms of behavior and physiology are driven by the biological clock that operates endogenously but can also be entrained to the light-dark cycle of the environment. In mammals, the master circadian pacemaker is located in the suprachiasmatic nucleus (SCN)
Liam C Hunt et al.
Cell reports, 28(5), 1268-1281 (2019-08-01)
Skeletal muscle cell (myofiber) atrophy is a detrimental component of aging and cancer that primarily results from muscle protein degradation via the proteasome and ubiquitin ligases. Transcriptional upregulation of some ubiquitin ligases contributes to myofiber atrophy, but little is known
Sung Tae Kim et al.
PloS one, 13(8), e0202260-e0202260 (2018-08-30)
The N-end rule pathway is a proteolytic system in which single N-terminal amino acids of proteins act as a class of degrons (N-degrons) that determine the half-lives of proteins. We have previously identified a family of mammals N-recognins (termed UBR1