Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGCCTTGCTTGTAAGGTGGACACTCACGCCCTGTACGCCATGAAGACCCTAAGGAAAAAGGATGTCCTGAACCGGAATCAGGTGGCCCACGTCAAGGCCGAGAGGGACATCCTGGCCGAGGCAGACAATGAGTGGGTGGTCAAACTCTACTACTCCTTCCAAGACAAAGACAGCCTGTACTTTGTGATGGACTACATCCCTGGTGGGGACATGATGAGCCTGCTGATCCGGATGGAGGTCTTCCCTGAGCACCTGGCCCGGTTCTACATCGCAGAGCTGACTTTGGCCATTGAGAGTGTCCACAAGATGGGCTTCATCCACCGAGACATCAAGCCTGATAACATTTTGATAGATCTGGATGGTCACATTAAACTCACAGATTTCGGCCTCTGCACTGGGTTCAGGTGGACTCACAATTCCAAATATTACCAGAAAGGGAGCCATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LATS2(26524)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cédric Belair et al.
Silence, 2(1), 7-7 (2011-10-27)
MicroRNAs, post-transcriptional regulators of eukaryotic gene expression, are implicated in host defense against pathogens. Viruses and bacteria have evolved strategies that suppress microRNA functions, resulting in a sustainable infection. In this work we report that Helicobacter pylori, a human stomach-colonizing
Ke Wang et al.
International journal of molecular medicine, 47(4) (2021-02-13)
Long non‑coding RNAs (lncRNAs) are a class of non‑protein coding transcripts that are involved in the regulation of gene expression in mammalian cells. Transcriptional co‑activator Yes associated protein 1 (YAP1) plays a key role in the progression of ovarian cancer.
Cong Dong et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(6), 475-481 (2015-03-19)
Many reports indicated LATS2 was a component of the Hippo pathway, could phosphorylate and inactivate YAP, acted as a tumor suppressor in human cancers. But few studies investigated the role of LATS2 in oral squamous cell carcinoma (OSCC) and clarified