Skip to Content
Merck

EHU098621

MISSION® esiRNA

targeting human H2AFY

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... H2AFY(9555)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



S-J Park et al.
Oncogene, 35(10), 1292-1301 (2015-06-02)
The histone variant, macroH2A1, has an important role in embryonic stem cell differentiation and tumor progression in various types of tumors. However, the regulatory roles of macroH2A1 on bladder cancer progression have not been fully elucidated. Here, we show that
Tânia Soraia Vieira-Silva et al.
Cancer cell international, 19, 112-112 (2019-06-06)
Prostate cancer (PCa), a major cause of cancer-related morbidity and mortality worldwide and mostly asymptomatic at earliest stages, is characterized by disruption of genetic and epigenetic balance. A better understanding of how those mechanisms orchestrate disease might improve diagnostic and
Nicolás G Simonet et al.
Science advances, 6(30), eaaz2590-eaaz2590 (2020-08-25)
Sirtuins are key players of metabolic stress response. Originally described as deacetylases, some sirtuins also exhibit poorly understood mono-adenosine 5'-diphosphate (ADP)-ribosyltransferase (mADPRT) activity. We report that the deacetylase SirT7 is a dual sirtuin, as it also features auto-mADPRT activity. SirT7