Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... H2AFY(9555)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
S-J Park et al.
Oncogene, 35(10), 1292-1301 (2015-06-02)
The histone variant, macroH2A1, has an important role in embryonic stem cell differentiation and tumor progression in various types of tumors. However, the regulatory roles of macroH2A1 on bladder cancer progression have not been fully elucidated. Here, we show that
Tânia Soraia Vieira-Silva et al.
Cancer cell international, 19, 112-112 (2019-06-06)
Prostate cancer (PCa), a major cause of cancer-related morbidity and mortality worldwide and mostly asymptomatic at earliest stages, is characterized by disruption of genetic and epigenetic balance. A better understanding of how those mechanisms orchestrate disease might improve diagnostic and
Nicolás G Simonet et al.
Science advances, 6(30), eaaz2590-eaaz2590 (2020-08-25)
Sirtuins are key players of metabolic stress response. Originally described as deacetylases, some sirtuins also exhibit poorly understood mono-adenosine 5'-diphosphate (ADP)-ribosyltransferase (mADPRT) activity. We report that the deacetylase SirT7 is a dual sirtuin, as it also features auto-mADPRT activity. SirT7