Skip to Content
Merck

EHU065071

MISSION® esiRNA

targeting human ITGB1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cherine Abou Faycal et al.
British journal of cancer, 118(12), 1596-1608 (2018-05-26)
While lung adenocarcinoma patients can somewhat benefit from anti-angiogenic therapies, patients with squamous cell lung carcinoma (SQLC) cannot. The reasons for this discrepancy remain largely unknown. Soluble VEGF receptor-1, namely sVEGFR1-i13, is a truncated splice variant of the cell membrane-spanning
Rayanah Barnawi et al.
International journal of cancer, 145(3), 830-841 (2019-02-06)
Breast cancer remains the second cause of tumor-related mortality in women worldwide mainly due to chemoresistance and metastasis. The chemoresistance and metastasis are attributed to a rare subpopulation with enriched stem-like characteristics, thus called Cancer Stem Cells (CSCs). We have
Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Kathleen Wantoch von Rekowski et al.
Biomolecules, 9(12) (2019-11-30)
Tumor cell binding to the microenvironment is regarded as the onset of therapeutic resistance, referred to as cell adhesion mediated drug resistance (CAM-DR). Here we elucidate whether CAM-DR occurs in ovarian cancer cells and contributes to still-existing cisplatin resistance. Cultivation
Zahia Hamidouche et al.
BMC cell biology, 11, 44-44 (2010-06-25)
The potential of mesenchymal stromal cells (MSCs) to differentiate into functional bone forming cells provides an important tool for bone regeneration. The identification of factors that trigger osteoblast differentiation in MSCs is therefore critical to promote the osteogenic potential of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service