Skip to Content
Merck

EHU073361

MISSION® esiRNA

targeting human PSEN1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTTTGGCAATTCTTCTTCTCAAGCACTGACACTCATTACCGTCTGTGATTGCCATTTCTTCCCAAGGCCAGTCTGAACCTGAGGTTGCTTTATCCTAAAAGTTTTAACCTCAGGTTCCAAATTCAGTAAATTTTGGAAACAGTACAGCTATTTCTCATCAATTCTCTATCATGTTGAAGTCAAATTTGGATTTTCCACCAAATTCTGAATTTGTAGACATACTTGTACGCTCACTTGCCCCAGATGCCTCCTCTGTCCTCATTCTTCTCTCCCACACAAGCAGTCTTTTTCTACAGCCAGTAAGGCAGCTCTGTCGTGGTAGCAGATGGTCCCATTATTCTAGGGTCTTACTCTTTGTATGATGAAAAGAATGTGTTATGAATCGGTGCTGTCAGCCCTGCTGTCAGACCTTCTTCCACAGCAAATGAGATGTATGCCCAAAGACGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PSEN1(5663)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Min-Hong Hsieh et al.
Molecules (Basel, Switzerland), 25(2) (2020-01-17)
Osteosarcoma, which is the most prevalent malignant bone tumor, is responsible for the great majority of bone cancer-associated deaths because of its highly metastatic potential. Although tomatidine is suggested to serve as a chemosensitizer in multidrug-resistant tumors, the anti-metastatic effect
Hongyu Zhang et al.
Frontiers in immunology, 11, 999-999 (2020-06-27)
Objective: Cancer-associated fibroblasts (CAFs) were associated with tumor progression in the tumor microenvironment (TME). However, their immunosuppressive roles in protecting cancer cells from the attack by cytotoxic T lymphocytes (CTLs) are not fully clear. In this study, we investigated whether
Sun-Ok Yoon et al.
Apoptosis : an international journal on programmed cell death, 19(11), 1616-1626 (2014-08-27)
Activating mutations in the NOTCH1 gene are found in over 50 % of T-ALL cases. Since Notch signaling contributes to the leukemia cell survival and growth, targeting Notch signaling using γ-secretase inhibitors (GSI) has been proposed as a molecularly targeted