Skip to Content
Merck

EMU184491

MISSION® esiRNA

targeting mouse Gapdh

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAGAAGGTGGTGAAGCAGGCATCTGAGGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACCAGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGTAAGAAACCCTGGACCACCCACCCCAGCAAGGACACTGAGCAAGAGAGGCCCTATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACCCCCATAATAACAGGAGGGGCCTAGGGAGCCCTCCCTACTCTCTTGAATACCATCAATAAAGTTCGCTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feifei Feng et al.
Environmental health perspectives, 120(12), 1692-1698 (2012-09-27)
The role of the Nlrp3 inflammasome in nonallergic airway hyperresponsiveness (AHR) has not previously been reported. Recent evidence supports both interleukin (IL) 1β and short fragments of hyaluronan (HA) as contributors to the biological response to inhaled ozone. Because extracellular
Shlomit Farkash-Amar et al.
PLoS genetics, 10(3), e1004176-e1004176 (2014-03-08)
To understand gene function, genetic analysis uses large perturbations such as gene deletion, knockdown or over-expression. Large perturbations have drawbacks: they move the cell far from its normal working point, and can thus be masked by off-target effects or compensation
Danielle Bartlett et al.
PloS one, 10(4), e0124154-e0124154 (2015-04-17)
Melanoma is a highly aggressive and drug resistant form of skin cancer. It arises from melanocytes, the pigment producing cells of the skin. The formation of these melanocytes is driven by the transcription factor PAX3 early during embryonic development. As
Jane L Roberts et al.
Cancer biology & therapy, 15(6), 758-767 (2014-03-22)
We determined whether clinically relevant phosphodiesterase 5 (PDE5) inhibitors interacted with clinically relevant chemotherapies to kill medulloblastoma cells. In medulloblastoma cells PDE5 inhibitors interacted in a greater than additive fashion with vincristine/etoposide/cisplatin to cause cell death. Knockdown of PDE5 expression
Seyedmehrad Tavallai et al.
Cancer biology & therapy, 15(5), 578-585 (2014-02-22)
The present studies were to determine whether the multi-kinase inhibitor pazopanib interacted with histone deacetylase inhibitors (HDACI: valproate, vorinostat) to kill sarcoma cells. In multiple sarcoma cell lines, at clinically achievable doses, pazopanib and HDACI interacted in an additive to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service