Skip to Content
Merck

EHU132211

MISSION® esiRNA

targeting human PDE6D

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCTGTCTGTCCCTGGTGTGGAGCATGAAGCCCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAACTTAATTTTTCTTCGACAGAACAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGGCAATGCCTAGAAGAATGGTTCTTCGAGTTTGGCTTTGTGATCCCTAACTCCACAAATACCTGGCAGTCCTTGATAGAGGCAGCACCCGAGTCCCAGATGATGCCAGCAAGCGTCTTAACTGGGAACGTTATCATAGAAACAAAGTTTTTTGACGACGATCTTCTTGTAAGCACATCCAGAGTGAGACTTTTCTATGTTTGAAAGAAGAATGTGTGTACATTTCAAGAATTTGGGTTTTTTGGAGGGAGGAGGAAACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PDE6D(5147)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sevdalina Nikolova et al.
Respiratory research, 11, 146-146 (2010-10-29)
Idiopathic Pulmonary Fibrosis (IPF) is an unresolved clinical issue. Phosphodiesterases (PDEs) are known therapeutic targets for various proliferative lung diseases. Lung PDE6 expression and function has received little or no attention. The present study aimed to characterize (i) PDE6 subunits
Michael Dumbacher et al.
Molecular neurodegeneration, 13(1), 50-50 (2018-09-28)
Neuronal Ca2+ dyshomeostasis and hyperactivity play a central role in Alzheimer's disease pathology and progression. Amyloid-beta together with non-genetic risk-factors of Alzheimer's disease contributes to increased Ca2+ influx and aberrant neuronal activity, which accelerates neurodegeneration in a feed-forward fashion. As

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service