Skip to Content
Merck

EHU137921

MISSION® esiRNA

targeting human IQGAP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IQGAP1(8826)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Shihong Su et al.
DNA and cell biology, 39(7), 1127-1140 (2020-05-05)
Pulmonary microvascular endothelium barrier plays a critical role in protecting the pulmonary tissue from inflammatory injury in acute respiratory distress syndrome and acute lung injury (ARDS/ALI). The dysregulation of IQ-GTPase-activating protein 1 (IQGAP1) was an important etiology of endothelium barrier
Bhavna Chawla et al.
The Journal of biological chemistry, 292(8), 3273-3289 (2017-01-14)
Insulin binds to the insulin receptor (IR) and induces tyrosine phosphorylation of the receptor and insulin receptor substrate-1 (IRS-1), leading to activation of the PKB/Akt and MAPK/ERK pathways. IQGAP1 is a scaffold protein that interacts with multiple binding partners and