Skip to Content
Merck

EHU051991

MISSION® esiRNA

targeting human MAP3K8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAAGCCAGGGGAATAGGTAGCCACATCTTGTTTGCAGATAAGAAAGGAAGCTAACGCAGTATCTGCAAAGCCAGGAGTCTGACTCAGTACTTTTCTCACTCATGCATACAAAGCAGCTAAAAATGACACAGCTTATTTACCATGCCCCTGACACTGCACTGAGCACTTTATGAGCTTGAACTCTGTTAATCCTCACGACCACCTCATGAGACTCTCCAGAAAGAGCAACAGTAATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGTCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTACCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAP3K8(1326)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Wayne Huey-Herng Sheu et al.
Arteriosclerosis, thrombosis, and vascular biology, 41(1), e46-e62 (2020-11-13)
Diabetic retinopathy, one of retinal vasculopathy, is characterized by retinal inflammation, vascular leakage, blood-retinal barrier breakdown, and neovascularization. However, the molecular mechanisms that contribute to diabetic retinopathy progression remain unclear. Approach and Results: Tpl2 (tumor progression locus 2) is a
Stefanie Voigt et al.
Nature communications, 11(1), 685-685 (2020-02-06)
IκB kinase 2 (IKK2) is well known for its pivotal role as a mediator of the canonical NF-κB pathway, which has important functions in inflammation and immunity, but also in cancer. Here we identify a novel and critical function of
D C Kanellis et al.
Oncogene, 34(19), 2516-2526 (2014-07-08)
Tumor Progression Locus 2 (TPL2) is widely recognized as a cytoplasmic mitogen-activated protein 3 kinase with a prominent role in the regulation of inflammatory and oncogenic signal transduction. Herein we report that TPL2 may also operate in the nucleus as