Skip to Content
Merck

EHU078041

MISSION® esiRNA

targeting human PMAIP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGACTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAATTTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGAATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCGAAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTGTTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PMAIP1(5366)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Zhenqian Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1574-1579 (2017-09-28)
Colorectal cancer (CRC) cells undergo apoptosis in the presence of the small-molecule inhibitor ABT-263 by up-regulating antiapoptotic Bcl-2 family members. However, the resistance to ABT-263 gradually developed in most solid tumors due to its low affinity to Mcl-1. Here, we
Patricia Gomez-Bougie et al.
Cancer letters, 383(2), 204-211 (2016-10-25)
As myeloma cells actively produce and secrete immunoglobulins, they are prone to ER stress, which if unresolved leads to apoptosis. We found that myeloma cell death induced by the ER stressor Thapsigargin was highly variable, ranging from 2 to 89%.
Eugene Y Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201800425R-fj201800425R (2018-05-26)
Rheumatoid arthritis (RA) is characterized by hyperplastic pannus formation mediated by activated synovial fibroblasts (RASFs) that cause joint destruction. We have shown earlier that RASFs exhibit resistance to apoptosis, primarily as a result of enhanced expression of myeloid cell leukemia-1