Skip to Content
Merck

EHU090841

MISSION® esiRNA

targeting human SCYL1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCGAGAAGCAAAAATTCTTCCAGGAGCTGAGCAAGAGCCTGGACGCATTCCCTGAGGATTTCTGTCGGCACAAGGTGCTGCCCCAGCTGCTGACCGCCTTCGAGTTCGGCAATGCTGGGGCCGTTGTCCTCACGCCCCTCTTCAAGGTGGGCAAGTTCCTGAGCGCTGAGGAGTATCAGCAGAAGATCATCCCTGTGGTGGTCAAGATGTTCTCATCCACTGACCGGGCCATGCGCATCCGCCTCCTGCAGCAGATGGAGCAGTTCATCCAGTACCTTGACGAGCCAACAGTCAACACCCAGATCTTCCCCCACGTCGTACATGGCTTCCTGGACACCAACCCTGCCATCCGGGAGCAGACGGTCAAGTCCATGCTGCTCCTGGCCCCAAAGCTGAACGAGGCCAACCTCAATGTGGAGCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michael Hannus et al.
Nucleic acids research, 42(12), 8049-8061 (2014-05-31)
Short interfering RNAs (siRNAs) are widely used as tool for gene inactivation in basic research and therapeutic applications. One of the major shortcomings of siRNA experiments are sequence-specific off-target effects. Such effects are largely unpredictable because siRNAs can affect partially
Carsten Riether et al.
Cell reports, 34(4), 108663-108663 (2021-01-28)
Self-renewal is a key characteristic of leukemia stem cells (LSCs) responsible for the development and maintenance of leukemia. In this study, we identify CD93 as an important regulator of self-renewal and proliferation of murine and human LSCs, but not hematopoietic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service