Skip to Content
Merck

EHU129271

MISSION® esiRNA

targeting human DDX5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nazia Abbasi et al.
Life science alliance, 3(10) (2020-08-21)
Tumorigenesis in different segments of the intestinal tract involves tissue-specific oncogenic drivers. In the colon, complement component 3 (C3) activation is a major contributor to inflammation and malignancies. By contrast, tumorigenesis in the small intestine involves fatty acid-binding protein 1
Hao Zhang et al.
Hepatology (Baltimore, Md.), 69(3), 1046-1063 (2018-10-04)
In hepatocellular carcinoma (HCC), dysregulated expression of DDX5 (DEAD box protein 5) and impaired autophagy have been reported separately. However, the relationship between them has not been explored. Here we present evidence to show that, by interacting with autophagic receptor
Yeon J Lee et al.
Genes & development, 32(15-16), 1060-1074 (2018-07-26)
Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites
Saravana Kumar Kailasam Mani et al.
Theranostics, 10(24), 10957-10972 (2020-10-13)
Rationale: RNA helicase DDX5 is downregulated during hepatitis B virus (HBV) replication, and poor prognosis HBV-related hepatocellular carcinoma (HCC). The aim of this study is to determine the mechanism and significance of DDX5 downregulation for HBV-driven HCC, and identify biologics
Sofiane Y Mersaoui et al.
The EMBO journal, 38(15), e100986-e100986 (2019-07-04)
Aberrant transcription-associated RNA:DNA hybrid (R-loop) formation often causes catastrophic conflicts during replication, resulting in DNA double-strand breaks and genomic instability. Preventing such conflicts requires hybrid dissolution by helicases and/or RNase H. Little is known about how such helicases are regulated.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service