Skip to Content
Merck

EMU002291

MISSION® esiRNA

targeting mouse Smpd1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGCCTCATCTCTCTCAATATGAATTTTTGTTCCCGTGAGAACTTTTGGCTCTTGATCAACTCCACAGATCCTGCTGGACAACTCCAGTGGCTGGTGGAGGAGCTTCAGGCTGCTGAGAATCGAGGAGACAAAGTGCATATAATTGGCCACATCCCTCCAGGACATTGTCTTAAGAGCTGGAGCTGGAATTATTACAAAATCATAGCCAGGTATGAAAACACTCTGGCCGGTCAGTTCTTTGGCCACACTCACGTGGATGAGTTTGAGATCTTCTATGATGAGGAAACTCTGAGCCGACCACTAGCTGTAGCCTTCCTGGCGCCCAGTGCTACAACCTTTATCAACCTTAACCCTGGCTACCGAGTTTACCAAATAGATGGAAACTACCCCGGAAGCTCTCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Vinay Shivanna et al.
Virology, 483, 218-228 (2015-05-20)
Our recent results demonstrated that bile acids facilitate virus escape from the endosomes into the cytoplasm for successful replication of porcine enteric calicivirus (PEC). We report a novel finding that bile acids can be substituted by cold treatment for endosomal
A Bai et al.
Cell death & disease, 6, e1828-e1828 (2015-07-24)
Acid sphingomyelinase (ASM), a lipid hydrolase enzyme, has the potential to modulate various cellular activation responses via the generation of ceramide and by interaction with cellular receptors. We have hypothesized that ASM modulates CD4(+) T-cell receptor activation and impacts immune

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service