Skip to Content
Merck

EMU069731

MISSION® esiRNA

targeting mouse Ror1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAATCCACCTCCCAGTATCCGCTGGTTCAAGAATGATGCACCTGTGGTCCAAGAACCTCGGAGAATCTCCTTCCGGGCAACCAACTATGGCTCTCGGCTGCGGATTAGAAACCTTGACACCACAGACACTGGTTACTTCCAGTGTGTGGCAACAAATGGCAAGAAAGTGGTGTCTACCACTGGTGTCCTGTTTGTCAAATTTGGGCCTCCTCCGACCGCAAGCCCAGGATCCTCAGATGAGTATGAAGAAGATGGATTCTGTCAGCCGTACCGAGGCATTGCATGTGCACGATTTATTGGCAACCGCACTGTGTATATGGAGTCTTTGCATATGCAGGGGGAAATAGAAAATCAGATCACAGCTGCCTTCACCATGATTGGCACCTCCAGCCATTTATCTGATAAGTGCTCTCAGTTCGCCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Annalen Bleckmann et al.
Clinical & experimental metastasis, 33(4), 309-323 (2016-02-11)
Liver metastasis development in breast cancer patients is common and confers a poor prognosis. So far, the prognostic significance of surgical resection and clinical relevance of biomarker analysis in metastatic tissue have barely been investigated. We previously demonstrated an impact
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service