Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGATCGGTGTCTCGAAGAGCTCGGACTGGAGACTAGGCCAGGTCTCCAGCAGAGGTGGATGTGCCTGCCAGTCACTGAAGGCGAGGATGACAGGTGTGGTCAATGTGACAGAAAGACATGACATGGTCCGGTGTGATGGAGAGGACAGAAGGGCAGTCATCCAGCCTTCTTGAACACCATGGGCTGGCGCCTTGTCGTAGAAGCCGTCTGTTCTTTCACTTTTCCCAAAGAGCTAACACTTCTCTGCTGCTCTCTGGATCCTCCTCCCCCTACCTTGAACCCTCAAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... H19(14955)
Related Categories
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Vinay Shivanna et al.
Virology, 483, 218-228 (2015-05-20)
Our recent results demonstrated that bile acids facilitate virus escape from the endosomes into the cytoplasm for successful replication of porcine enteric calicivirus (PEC). We report a novel finding that bile acids can be substituted by cold treatment for endosomal
A Bai et al.
Cell death & disease, 6, e1828-e1828 (2015-07-24)
Acid sphingomyelinase (ASM), a lipid hydrolase enzyme, has the potential to modulate various cellular activation responses via the generation of ceramide and by interaction with cellular receptors. We have hypothesized that ASM modulates CD4(+) T-cell receptor activation and impacts immune
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service