Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTK2(5747)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qianfeng Zhuang et al.
Acta biochimica et biophysica Sinica, 50(5), 465-472 (2018-04-13)
Calpain small subunit 1 (Capn4) has been shown to correlate with the metastasis/invasion of clear cell renal cell carcinoma (ccRCC). This study aimed to further elucidate the molecular mechanisms underlying Capn4-mediated ccRCC progression. The mRNA expression levels in ccRCC cells
Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Chang Liu et al.
Cancer medicine, 10(1), 337-349 (2020-12-07)
Lidocaine, one of the most commonly used local anesthetics during surgery, has been reported to suppress cancer cell growth via blocking voltage-gated sodium channels (VGSCs). VGSC 1.5 (NaV 1.5) is highly expressed in invasive cancers including ovarian cancer. This study