Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CFLAR(8837)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yao Wang et al.
Frontiers in oncology, 9, 857-857 (2019-09-26)
Immune checkpoint blockade of programmed cell death protein 1 (PD-1) had an impressive long-lasting effect in a portion of advanced-stage melanoma patients, however, this therapy failed to induce responses in several patients; how to increase the objective response rate is
Tae-Eun Kim et al.
Oncotarget, 8(8), 13957-13970 (2017-01-14)
In this study, we examined the molecular mechanism underlying the resistance of cancer cells to R27T, a glycoengineered version of recombinant human interferon (IFN)-β1a, and sought to overcome R27T resistance through combination therapy. R27T has been shown to induce anti-proliferation
X Song et al.
Cell death & disease, 4, e577-e577 (2013-04-06)
Colorectal cancer is the third leading cause of cancer-related mortality in the world; the main cause of death of colorectal cancer is hepatic metastases, which can be treated with hyperthermia using isolated hepatic perfusion (IHP). In this study, we report