Skip to Content
Merck

EHU010131

MISSION® esiRNA

targeting human ZEB2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACAGATCAGCACCAAATGCTAACCCAAGGAGCAGGTAATCGCAAGTTCAAATGCACAGAGTGTGGCAAGGCCTTCAAATATAAACACCATCTGAAAGAACACCTGCGAATTCACAGTGGTGAAAAACCTTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCATTCTGGTTCCTACAGTTCGCACATCAGCAGCAAGAAATGTATTGGTTTAATCTCTGTAAATGGCCGAATGAGAAACAATATCAAGACGGGTTCTTCCCCTAATTCTGTTTCTTCTTCTCCTACTAATTCAGCCATTACCCAGTTAAGAAACAAGTTGGAGAATGGAAAACCACTTAGTATGTCTGAACAGACAGGCTTACTTAAAATTAAAACAGAACCACTAGACTTCAATGACTATAAAGTTCTTATGGCTACACACGGGTTTAGTGGCACTAGTCCCTTTATGAATGGTGGGCTTGGAGCCACCAGCCCTTTAGGAGTTCATCCATCTGCTCAGAGTCCAATGCAGCACTTAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ZEB2(9839)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


D-M Geng et al.
European review for medical and pharmacological sciences, 21(8), 1746-1752 (2017-05-10)
To investigate the effect of ZEB2 silencing on cisplatin resistance in gastric cancer. The resulting cell line, SGC7901/DDP, was transfected with ZEB2 siRNA, non-specific siRNA, or vehicle control. The effectiveness of ZEB2 silencing was evaluated by reverse transcriptase-polymerase chain reaction
Sanchari Roy et al.
Clinical science (London, England : 1979), 130(14), 1197-1207 (2016-04-30)
miR-192-5p has gained increasing relevance in various diseases, however, its function in acute liver injury is currently unknown. We analysed miR-192-5p serum levels and hepatic miR-192-5p expression in mice after hepatic ischaemia and reperfusion (I/R) as well as in toxic
Steven Goossens et al.
Blood, 129(8), 981-990 (2017-01-11)
Elevated expression of the Zinc finger E-box binding homeobox transcription factor-2 (ZEB2) is correlated with poor prognosis and patient outcome in a variety of human cancer subtypes. Using a conditional gain-of-function mouse model, we recently demonstrated that ZEB2 is an