Skip to Content
Merck

EHU023011

MISSION® esiRNA

targeting human ID3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCTTCCTCATTCTTTGAATCCGCGGCTCCGCGGTCTTCGGCGTCAGACCAGCCGGAGGAAGCCTGTTTGCAATTTAAGCGGGCTGTGAACGCCCAGGGCCGGCGGGGGCAGGGCCGAGGCGGGCCATTTTGAATAAAGAGGCGTGCCTTCCAGGCAGGCTCTATAAGTGACCGCCGCGGCGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCCCGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGCGGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGCGCGTCATCGACTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ID3(3399)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Sachindra et al.
Oncotarget, 8(66), 110166-110175 (2018-01-05)
Adaptive resistance to targeted therapy such as BRAF inhibitors represents in melanoma a major drawback to this otherwise powerful treatment. Some of the underlying molecular mechanisms have recently been described: hyperactivation of the BRAF-MAPK pathway, of the AKT pathway, of
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Jayanta K Das et al.
PloS one, 9(8), e104159-e104159 (2014-08-05)
Microvascular lesions resulting from endothelial cell dysfunction are produced in the brain, lung, kidney, and retina of patients of complex chronic diseases. The environmental and molecular risk factors which may contribute in the development of microvascular damage are unclear. The