Skip to Content
Merck

EHU078241

MISSION® esiRNA

targeting human TJP1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

NCBI accession no.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Alan S Fanning et al.
Molecular biology of the cell, 23(4), 577-590 (2011-12-23)
The structure and function of both adherens (AJ) and tight (TJ) junctions are dependent on the cortical actin cytoskeleton. The zonula occludens (ZO)-1 and -2 proteins have context-dependent interactions with both junction types and bind directly to F-actin and other
N T K Vo et al.
Journal of fish diseases, 39(2), 175-188 (2015-02-04)
A cell line, WE-cfin11e, with an epithelial-like morphology was developed from a caudal fin of walleye, Sander vitreus (Mitchill), characterized as distinct from the established walleye caudal fin fibroblast-like cell line, WE-cfin11f, and compared with WE-cfin11f for susceptibility to VHSV

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service