Skip to Content
Merck

EHU078251

MISSION® esiRNA

targeting human CTH

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTH(1491)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Daoliang Xu et al.
Pharmacological research, 117, 357-369 (2017-01-15)
It has been suggested that excessive apoptosis in intervertebral disc cells induced by inflammatory cytokines, such as interleukin (IL)-1β, is related to the process of intervertebral disc degeneration (IVDD). Hydrogen sulfide (H
Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has