Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CTH(1491)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Daoliang Xu et al.
Pharmacological research, 117, 357-369 (2017-01-15)
It has been suggested that excessive apoptosis in intervertebral disc cells induced by inflammatory cytokines, such as interleukin (IL)-1β, is related to the process of intervertebral disc degeneration (IVDD). Hydrogen sulfide (H
Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has