Skip to Content
Merck

EHU039471

MISSION® esiRNA

targeting human NBN

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATGCTCCAAAGGCAAGGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAGAATTACTGTGATCCTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCAAGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACTACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGGCCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGATGCACCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACTTTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAATAAAAGTAAAGATAGGGCTTCTCAGCAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NBN(4683)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Katie Myers et al.
PLoS genetics, 5(1), e1000324-e1000324 (2009-01-03)
The related PIK-like kinases Ataxia-Telangiectasia Mutated (ATM) and ATM- and Rad3-related (ATR) play major roles in the regulation of cellular responses to DNA damage or replication stress. The pro-apoptotic role of ATM and p53 in response to ionizing radiation (IR)
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a
Daniel C Anacker et al.
Journal of virology, 88(15), 8528-8544 (2014-05-23)
Activation of the ATM (ataxia telangiectasia-mutated kinase)-dependent DNA damage response (DDR) is necessary for productive replication of human papillomavirus 31 (HPV31). We previously found that DNA repair and homologous recombination (HR) factors localize to sites of HPV replication, suggesting that