Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCTTCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTTCCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATG5(9474)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
ATG5 (autophagy protein 5) is involved in the formation of autophagosomes. It is part of the E3-like ATG12-ATG5-ATG16 complex, which is involved with autophagic vesicle formation and expansion. ATG5 is also needed for antigen presentation and thereby enhances viral clearance. Mutation in this gene decreases autophagy, thereby causing ataxia with developmental delay. The ATG5 gene is upregulated in systemic lupus erythematosus. It is also associated with Behçet′s disease. Polymorphisms in this gene are linked with neutrophilic airway inflammation, particularly in adult asthma.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay.
Kim M
eLife, 5, e12245-e12245 (2016)
Yiming Shao et al.
Scientific reports, 7(1), 9399-9399 (2017-08-26)
Previous studies demonstrated significant roles of autophagy in the pathogenesis of sepsis, but few studies focused on the effect of autophagy-related SNPs on sepsis susceptibility. In this present study, five polymorphisms of ATG5/ATG16L1 were investigated for the possible risk on
Association of ATG5 Gene Polymorphisms With Behcet's Disease and ATG10 Gene Polymorphisms With VKH Syndrome in a Chinese Han Population.
Zheng M
Investigative Ophthalmology & Visual Science, 56, 8280-8280 (2015)