Skip to Content
Merck

EHU051011

MISSION® esiRNA

targeting human PLK1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PLK1(5347)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Owen Addis Jones et al.
Nature communications, 10(1), 2861-2861 (2019-06-30)
Centromeres provide a pivotal function for faithful chromosome segregation. They serve as a foundation for the assembly of the kinetochore complex and spindle connection, which is essential for chromosome biorientation. Cells lacking Polo-like kinase 1 (PLK1) activity suffer severe chromosome alignment
Yih-Gang Goan et al.
Cancers, 11(8) (2019-08-08)
Oral squamous cell carcinoma (OSCC) is one of the major leading causes of cancer-related death worldwide, with limited effective markers for diagnosis and therapy, which has caused a low overall survival rate in the past decades. Kinases play important roles
Hui Shi et al.
International journal of nanomedicine, 15, 3347-3362 (2020-06-05)
Temozolomide (TMZ) is the first-line chemotherapeutic option to treat glioma; however, its efficacy and clinical application are limited by its drug resistance properties. Polo-like kinase 1 (PLK1)-targeted therapy causes G2/M arrest and increases the sensitivity of glioma to TMZ. Therefore
Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service