Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATGGAAATTCTGGACACCCGCTGGTCCTCAGCTACATCGACCTGTCAGCCTGGTGTTACTACTGTCAGGCCTATGTCCACCACCAGGCTCTCCTAGATGTGAAGAACATCGCCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACCTTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCACTGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGAACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAGAAGGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HDAC6(10013)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mo Cheng et al.
European journal of pharmacology, 840, 1-8 (2018-10-03)
Emerging evidence shows that cytokines such as interleukins (ILs) are involved in the progression and chemoresistance of multiple tumors, including osteosarcoma (OS). Our present study established the doxorubicin (Dox) resistant human OS MG-63 and HOS cells and named them MG-63/Dox
Lei Yang et al.
Journal of molecular and cellular cardiology, 127, 143-153 (2018-12-26)
Extracellular pH strongly affects cellular metabolism and function. An acidic environment induced under pathological conditions leads to cardiomyocyte injury and dysfunction, but the underlying mechanisms are still poorly understood. Autophagy has been reported as a cytoprotective mechanism that maintains cellular
Hyeanjeong Jeong et al.
International journal of molecular sciences, 20(17) (2019-09-05)
Epigenetic remodeling via histone acetylation has become a popular therapeutic strategy to treat Alzheimer's disease (AD). In particular, histone deacetylase (HDAC) inhibitors including M344 and SAHA have been elucidated to be new drug candidates for AD, improving cognitive abilities impaired