Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STC1(6781)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fei Zhao et al.
Oxidative medicine and cellular longevity, 2020, 1898213-1898213 (2020-04-23)
Contrast-induced acute kidney injury (CI-AKI) is the third common cause of acute kidney injury (AKI), which is associated with poor short- and long-term outcomes. Currently, effective therapy strategy for CI-AKI remains lacking. Stanniocalcin-1 (STC1) is a conserved glycoprotein with antiapoptosis
Wenru Su et al.
Journal of molecular cell biology, 9(4), 289-301 (2017-06-29)
Mesenchymal stem cells (MSCs) have been demonstrated to have promising therapeutic benefits for a variety of neurological diseases; however, the underlying mechanisms are poorly understood. Here, we showed that intravitreal infusion of MSCs promoted retinal ganglion cell (RGC) survival in
Dong Dai et al.
Oncology reports, 35(1), 552-558 (2015-11-05)
The new anti-aging gene Klotho has been identified as a multi-functional humoral factor which influences multiple biological processes, including tumor progression. Although ample evidence indicates that Klotho plays important roles in cervical, lung and breast cancer, the role and mechanism