Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGCATGGACTGTAGGCAGAATTTGTGAGCTGCTTCCTGAAGCTGCCATCAATGATGTCTACTTGGCTCCCCTGCTACAGTGTCTGATTGAGGGTCTCAGTGCTGAACCCAGAGTGGCTTCAAATGTGTGCTGGGCTTTCTCCAGTCTGGCTGAAGCTGCTTATGAAGCTGCAGACGTTGCTGATGATCAGGAAGAACCAGCTACTTACTGCTTATCTTCTTCATTTGAACTCATAGTTCAGAAGCTCCTAGAGACTACAGACAGACCTGATGGACACCAGAACAACCTGAGGAGTTCTGCATATGAATCTCTGATGGAAATTGTGAAAAACAGTGCCAAGGATTGTTATCCTGCTGTCCAGAAAACGACTTTGGTCATCATGGAACGACTGCAACAGGTTCTTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KPNB1(3837)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Noboru Sekimoto et al.
Journal of Cancer, 8(19), 4125-4140 (2017-12-01)
Lung cancer is a major cause of death worldwide, with lung adenocarcinoma being the most frequently diagnosed subtype in Japan. Finding the target of an anticancer drug can improve lung adenocarcinoma treatments. Polo-like kinase 1 (PLK1) is an essential mitotic
Michiko Kodama et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(35), E7301-E7310 (2017-08-16)
Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has not been changed significantly during several decades. To seek new therapeutic targets for EOC, we performed an in vivo dropout screen in human tumor xenografts using a pooled
Zhen Wang et al.
Emerging microbes & infections, 9(1), 2030-2045 (2020-09-03)
The interferon-inducible myxovirus resistance B (MxB) protein has been reported to inhibit HIV-1 and herpesviruses by blocking the nuclear import of viral DNA. Here, we report a new antiviral mechanism in which MxB restricts the nuclear import of HIV-1 regulatory